Types of mutations. Genomic and chromosomal mutations

Mutations

1. What cells are called polyploid
A) containing more than two sets of homologous chromosomes
B) obtained as a result of hybridization
B) containing multiallelic genes
D) obtained from crossing several pure lines

2. Rotating a section of a chromosome by 180 degrees refers to mutations
A) genomic
B) genetic
B) chromosomal
D) point

3. Somatic mutations are passed on to offspring
A) plants during vegetative propagation
B) animals during sexual reproduction
B) animals that reproduce parthenogenetically
D) plants with double fertilization

4. Reasons gene mutations- these are violations that occur when
A) DNA reduplication
B) biosynthesis of carbohydrates
B) formation of ATP
D) synthesis of amino acids

5. Polyploid organisms arise as a result
A) genomic mutations
B) modification variability
B) gene mutations
D) combinative variability

6. What type of mutations are changes in the DNA structure in mitochondria?
A) genomic
B) chromosomal
B) cytoplasmic
D) combinative

7. It is possible for breeders to obtain polyploid wheat varieties due to mutation
A) cytoplasmic
B) genetic
B) chromosomal
D) genomic

8. Loss of a chromosome section, in contrast to the crossing of chromatids in meiosis, is
A) conjugation
B) mutation
B) replication
D) crossing over

9. Variegation of night beauty and snapdragon is determined by variability
A) combinative
B) chromosomal
B) cytoplasmic
D) genetic

10. Polyploid wheat varieties are the result of variability
A) chromosomal
B) modification
B) genetic
D) genomic

12. An animal in whose offspring a trait due to a somatic mutation may appear
A) hydra
B) wolf
B) hedgehog
D) otter

13. A change in the sequence of nucleotides in a DNA molecule is a mutation
A) genetic
B) genomic
B) chromosomal
D) autosomal

14. The loss of four nucleotides in DNA is
A) modification change
B) gene mutation
B) chromosomal mutation
D) genomic mutation

15. Polyploidy is one of the forms of variability
A) modification
B) mutational
B) combinative
D) correlative

16. Which human disease is the result of a gene mutation?
A) acquired immunodeficiency syndrome
B) flu
B) sickle cell anemia
D) hepatitis

17. Down's disease is associated with the appearance of an extra 21st pair of chromosomes in the human genotype, therefore such a change is called
A) somatic mutation
B) genomic mutation
B) polyploidy
D) heterosis

18. Mutations associated with the exchange of sections of non-homologous chromosomes are classified as
A) chromosomal
B) genomic
B) point
D) genetic

19. Variability of organisms caused by a multiple increase in sets of chromosomes in cells is
A) gene mutation
B) polyploidy
B) heterosis
D) point mutation

20. You can increase the frequency of mutations in a population
A) the effect of x-rays on individuals
B) interspecific crosses
B) by crossing pure lines
D) crossing heterozygous organisms

21. Recessive gene mutations change
A) sequence of stages of individual development
B) composition of triplets in a DNA section
B) set of chromosomes in somatic cells
D) structure of autosomes

22. Somatic mutations
A) are caused by changes in autosomes in germ cells
B) associated with sex-linked inheritance
C) transmitted to offspring in plants during vegetative propagation
D) arise in gametes in animals

23. Down syndrome is the result of a mutation
1) genomic
2) cytoplasmic
3) chromosomal
4) recessive

24. The birth of a child with Down syndrome is an example of variability
A) modification
B) combinative
B) cytoplasmic
D) genomic

25. What cells are called polyploid?
A) having a multiple increased number of chromosomes
B) containing dominant genes
B) obtained as a result of hybridization
D) obtained from crossing pure lines

26. Somatic mutations in humans
A) are not inherited by offspring
B) increase metabolic rate
C) serve as the basis for adaptation
D) arise in gametes

27. Somatic mutations in vertebrates
A) are formed in gametes
B) are passed on to the next generation
C) arise in the cells of body organs
D) caused by metabolic disorders

28. Mutational variability is due to
A) recombination of genes in homologous chromosomes
B) a change in the sequence of nucleotides in DNA
C) a change in the characteristic within the normal range of reaction
D) the formation of hybrid offspring

Gene mutations, tasks for gene mutations.Gene mutation is a change in the nucleotide sequence of one gene.

Types of gene mutations:

1. Replacement of one nucleotide in a gene with another nucleotide (missense mutation). Occurs due to an error in DNA polymerase during DNA replication.

Consequences of missense mutations:

a) A missense mutation leads to a change in the primary structure and function of the corresponding protein if the codon resulting from the mutation encodes a new amino acid.

Before mutation:

DNA: ATGCCAAGGGA

mRNA: UACGGGUUUCCC

After mutation:

DNA: ATGCCAAA T GGA

mRNA: UACGGGUUU A CCU

Lei About

As a result of the mutation, one amino acid was replaced, therefore, the primary structure and function of the protein changed.

b) A missense mutation does not lead to a change in the primary structure and function of the corresponding protein if the codon formed as a result of the mutation encodes the same amino acid as the original one (due to the degeneracy of the genetic code).

Before mutation:

DNA: ATGCCAAGGGA

mRNA: UACGGGUUUCCC

primary protein: Tire Gly Fen Pro

After mutation:

DNA: ATGCCAAA A GGA

mRNA: UACGGGUUU U CCU

primary protein: Tire Gly Fen Pro

As a result of the mutation, G was replaced by A in the DNA sequence. However, this mutation did not lead to a change in the structure and function of the corresponding protein, since the new codon UUU encodes the same amino acid (Phen) as the original one - UUC.

1. Deletion or insertion of one or more codons within the nucleotide sequence of a gene. Single codon drop occurs due to an error by DNA polymerase during DNA replication and results in the loss of one amino acid from the primary structure of the protein. Accordingly, such a mutation leads to changes in the structure and function of the corresponding protein.

Before mutation:

DNA: ATGCCAAGGGA

mRNA: UACGGGUUUCCC

primary protein: Tire Gly Fen Pro

After mutation:

DNA: ATGAAGGGA

mRNA: UATSUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUT

primary protein: Tire Fen Pro

1. Insertion or deletion of one or two nucleotides (Open Reading Frame Shift Mutation). Occurs due to an error in DNA polymerase during DNA replication. This mutation leads to a change in all amino acids in the primary structure of the protein, starting from the point of mutation. This in most cases leads to complete violation protein structure and function.

Before mutation:

DNA: ATGCCATAAGC

mRNA: UACGGGUAUUCG

The mutation resulted in the insertion of 1 nucleotide

After mutation:

DNA: ATG G TCCATAAGTS

mRNA: UAC C YGGYAUUCG

primary protein str.: TyrArg Val Fen

1. The appearance of a stop codon in the coding part of the gene (nonsense mutation). As a result, the polypeptide chain of the corresponding protein becomes shorter, which leads to a significant change in the primary structure and function of the protein.

Before mutation:

DNA: ATGCCATAAGC

mRNA: UACGGGUAUUCG

primary protein structure: Tyr Gly Tyr Ser

There was a replacement of T with C in the nucleotide sequence of the corresponding gene. As a result, a stop codon, UAG, appeared in the coding part of the mRNA, which led to a premature stop of translation.

After mutation:

DNA: ATGCCCA C AAGC

mRNA: UACGGGUA G UCG

primary protein source: Tyr Gly

One of the tasks of the Unified State Exam on the topic “Gene Mutations”

Problem 6

As a result of a gene mutation in the polypeptide chain of the corresponding protein, the amino acid About replaced by Cis. mRNA sequence before mutation: GTSUUUUTCGATSUCA. Define amino acid composition molecules of normal and mutated protein, as well as possible nucleotide sequences of mutated mRNA. Explain your answer.

Before mutation:

mRNA: GCUUUCCCCCGATCUCA

protein: Ala Fen Pro Asp Ser

Reason for replacing the third amino acid About on Cis was a gene mutation in the nucleotide sequence of the corresponding gene, as a result of which a change occurred in the triplet in the composition of the mRNA encoding the third amino acid. Based on the degeneracy property of the genetic code, the amino acid Cis can be encoded by two possible triplets - YES, UGC. Accordingly, any of these triplets could appear as a result of a mutation in the mRNA. Most likely UGC, since in this case the least number of nucleotides must be replaced.

Variants of the mutated mRNA sequence: GTSUUUTSUGUGATSUCA; GTSUUUTSUGTSGATSUCA

After mutation:

mRNA: GTSUUUC UG TSGATSCA

protein: Ala Fen Cis Asp Ser

Answer: mRNA sequences with mutation: GTSUUUTSUGUGATSUCA; GTSUUUTSUGTSGATSUCA.

Primary structure of normal protein: Ala Fen Pro Asp Ser

Primary protein structure after mutation: Ala Fen Cys Asp Ser

Hereditary (genotypic) variability manifests itself in a change in the genotype of an individual, therefore it is transmitted through sexual reproduction to descendants.

Hereditary variability is due to the occurrence of different types of mutations and their combinations in subsequent crosses. In each sufficiently long-existing population of individuals, various mutations arise spontaneously and undirectedly, which are subsequently combined more or less randomly with existing gene variants.

Types of hereditary variability:

• combinative: caused by the recombination of genes as a result of meiosis and fertilization;
• mutational: caused by the occurrence of mutations.

Combinative variability

Combinative called variability, which is based on education recombinations, i.e., such combinations of genes that the parents did not have.

The basis of combinative variability is sexual reproduction organisms, resulting in a huge variety of genotypes. Three processes serve as virtually unlimited sources of genetic variation during sexual reproduction in eukaryotes:

1. Independent segregation of homologous chromosomes in anaphase of the first meiotic division. It is the independent combination of chromosomes during meiosis that is the basis of Mendel's third law. The appearance of green smooth and yellow wrinkled pea seeds in the second generation from crossing plants with yellow smooth and green wrinkled seeds is an example of combinative variability.
2. Mutual exchange of sections of homologous chromosomes, or crossing over, in the prophase of the first division of meiosis. It creates new linkage groups, i.e. it serves as an important source of genetic recombination of alleles. Recombinant chromosomes, once in the zygote, contribute to the appearance of characteristics that are atypical for each of the parents.
3. Random combination of gametes during fertilization.

These sources of combinative variability act independently and simultaneously, ensuring constant “shuffling” of genes, which leads to the emergence of organisms with a different genotype and phenotype (the genes themselves do not change). However, new gene combinations break down quite easily when passed on from generation to generation. Combinative variability is the most important source of all the colossal hereditary diversity characteristic of living organisms. However, as a rule, it does not generate stable changes in the genotype, which, according to evolutionary theory, are necessary for the emergence of new species. Stable, long-lived changes arise as a result of mutations.

Mutational variability

Mutation is a stable and non-directional change in the genome.

The mutation persists indefinitely over a number of generations.

The significance of mutations in evolution is enormous - thanks to them, new gene variants arise. They say that mutations are the raw material of evolution. Mutations are individual (each mutation in a separate DNA molecule occurs randomly) and non-directional.

Mutations may or may not lead to changes in the characteristics and properties of the organism.

Mutations occur constantly throughout human ontogenesis. Than more early stage development of the organism, a specific mutation will arise, the greater the impact it can have on the development of the organism (Fig. 1).

Rice. 1. Impact of mutations in different periods ontogeny

Mutations are divided into:

• neutral;
• harmful;
• useful.

Modern geneticists believe that most newly emerging mutations neutral, that is, they do not affect the fitness of the organism in any way. Neutral mutations occur in intergenic regions - introns (sections of DNA that do not code for proteins); either this synonymous mutations in the coding part of the gene - mutations that lead to the appearance of a codon designating the same amino acid (this is possible due to the degeneracy of the genetic code).

The next most common are harmful mutations. The harmful effect of mutations is explained by the fact that the changes concern hereditary traits that most often have adaptive significance, that is, traits that are useful in given environmental conditions.

Only a small part of mutations increases the fitness of the organism, that is, it is useful(“breaking does not build”).

However, the harmfulness and usefulness of mutations are relative concepts, since what is useful (harmful) under given conditions may have the opposite effect when environmental conditions change. That is why mutations are the material for evolution.

Mutagenesis- the process of mutation occurrence.

Mutations can appear in both somatic and germ cells (Fig. 2).

Rice. 2. Result of mutations

Despite the fact that mutations occur constantly, there are a number of factors, the so-called mutagens, increasing the likelihood of mutations occurring.

Mutagens are factors that increase the likelihood of mutations.

Mutagens can be:

• chemicals (acids, alkalis, etc.);
• temperature effects;
• UV radiation;
• radiation;
• viruses.

Carcinogens- factors that increase the likelihood of occurrence malignant neoplasms(tumors) in animals and humans.

According to the nature of the genome change, mutations are distinguished:

• gene (point)
• chromosomal
• genomic

GENE MUTATIONS

Genetic, or point mutations --the result of a change in the nucleotide sequence in a DNA molecule within one gene.

If such a mutation occurs in a gene, it results in a change in the mRNA sequence. And a change in the sequence of mRNA can lead to a change in the sequence of amino acids in the polypeptide chain. As a result, another protein is synthesized, and some characteristic changes in the body.

This is the most common type of mutation and the most important source of hereditary variability in organisms.

There are different types gene mutations associated with the addition, deletion or rearrangement of nucleotides in a gene:

• duplications- repetition of a gene section,
• inserts- the appearance of an extra pair of nucleotides in the sequence,
• deletions--loss of one or more nucleotide pairs,
• nucleotide pair substitutions- AT -><- ГЦ; AT -> <- ЦГ; или AT -> <- ТА,
• inversions- flipping a gene section by 180°.

The effects of gene mutations are extremely varied.

Most of them are neutral mutations.

CHROMOSOMAL MUTATIONS

Chromosomal mutations- These are changes in the structure of chromosomes. Typically, they can be identified and studied under a light microscope.
Different types of chromosomal rearrangements are known:

• deletion- loss of a chromosome section in its middle part;
• duplication- double or multiple repetition of genes localized in a certain region of the chromosome;
• inversion- rotation of a chromosome section by 180°, as a result of which genes in this section are located in the reverse sequence compared to the usual one;
• translocation- change in the position of any part of a chromosome in the chromosome set. The most common type of translocation is the exchange of sections between two non-homologous chromosomes. A section of a chromosome can change its position without exchange, remaining in the same chromosome or being included in some other one.

GENOMIC MUTATIONS

TO genomic mutationsrefers to a change in the number of chromosomes:

• aneuploidy;
• polyploidy.

Aneuploidy- increase or decrease in the number of chromosomes in the genotype.

It occurs when chromosomes do not separate in meiosis or chromatids in mitosis.

Aneuploids are found in plants and animals and are characterized by low viability.

Due to the nondisjunction of any pair of homologous chromosomes in meiosis, one of the resulting gametes contains one chromosome less, and the other contains one chromosome more, than in the normal haploid set. When merging with another gamete, a zygote appears with a smaller or larger number of chromosomes compared to the diploid set characteristic of the species. An example is trisomy 21 (extra 21st chromosome), leading to Down syndrome (Fig. 3).

Rice. 3. Down syndrome

Polyploidy- this is a multiple increase in the haploid set of chromosomes (Зn, 4n, etc.).

Most often it appears when there is a violation of the divergence of chromosomes to the poles of the cell in meiosis or mitosis under the influence of mutagenic factors.

It is widespread in plants and protozoa and extremely rare in animals.

With an increase in the number of chromosome sets in the karyotype, the reliability of the genetic system increases and the likelihood of decreased viability in the event of mutations decreases. Therefore, polyploidy often entails an increase in viability, fertility and other life properties (Fig. 4).

Rice. 4. Common and polyploid evening primrose plant

In plant growing, this property is used to artificially obtain polyploid varieties of cultivated plants that are characterized by high productivity.

In higher animals, polyploidy, as a rule, does not occur (exceptions are known among amphibians and rock lizards).

Hereditary diseases

In a diploid organism, most new mutations do not manifest themselves phenotypically because they are recessive. This is very important for the existence of the species, since most newly occurring mutations are harmful. However, their recessive nature allows them to persist for a long time in individuals of the species in a heterozygous state without harm to the body and manifest themselves in the future upon transition to a homozygous state.

Hereditary diseases:

• interlocked with the floor(genes on sex chromosomes - color blindness, hemophilia);
  
  Klinefelter syndrome is a pathology characterized by the presence of an extra X chromosome (at least one) in boys, as a result of which their puberty is disrupted. The disease was first described by Klinefelter in 1942. Some boys may have 3, 4 or 5 X chromosomes with one Y chromosome. As the number of X chromosomes increases, the severity of developmental defects and mental retardation also increases. For example, the variant of chromosome set 43 XXXXXV has so many characteristic features that it can be diagnosed in childhood (Fig. 5).
  

  

• Rice. 5. Klinefelter syndrome

  • autosomal dominant(in autosomes, Aa and AA): appear more often → are more subject to natural selection;
  • autosomal recessive(in autosomes, aa only): manifest less frequently → are less subject to natural selection → persist in populations longer; more often manifested in closely related crossings (isolated populations, ethnic and religious groups, ruling dynasties, etc.).

  Many autosomal recessive diseases are associated with metabolic disorders.

  For example, phenylketonuria- 1 in 1000 cases. There is no enzyme that converts the amino acid phenylalanine into tyrosine → accumulation of phenylalanine → damage to the nervous system → dementia (Fig. 6).

  

  Rice. 6. Patient with phenylketonuria

  Leucinosis- a severe hereditary disease that is associated with a violation of amino acid metabolism and has an autosomal recessive type of inheritance. The disease is better known as maple syrup disease. The disease got its name because of the specific smell of urine, which is similar to the smell of maple syrup. With this pathology, the child’s body is unable to absorb amino acids: leucine, isoleucine, valine. Urine acquires a specific odor due to the presence of a substance formed from leucine.

  At the same time, there are a number of cases where a change in only one base in a certain gene has a noticeable effect on the phenotype (gene mutation).

  One example of a gene mutation is sickle cell anemia. The recessive allele, which causes this hereditary disease in the homozygous state, is expressed in the replacement of just one amino acid residue in the β-chain of the hemoglobin molecule (glutamic acid → valine). This leads to the fact that in the blood red blood cells with such hemoglobin are deformed (from round to sickle-shaped) and quickly destroyed (Fig. 7). In this case, acute anemia develops and a decrease in the amount of oxygen carried by the blood is observed. Anemia causes physical weakness, problems with the heart and kidneys, and can lead to early death in people homozygous for the mutant allele.

  

  Rice. 7. Normal red blood cell and red blood cell in sickle cell anemia
  

  Cytoplasmic variability

  Cytoplasmic mutations- associated with mutations of genes located in mitochondrial DNA and plastid DNA.

  During sexual reproduction cytoplasmic mutationsinherited through the mother's line, since during fertilization the zygote receives all the cytoplasm from the egg.

  In higher plants, variegated mutants in some cases are an example of the occurrence plastid mutations. For example: the variegation of night beauty (Fig. 8) and snapdragon (Fig. 9) is associated with mutations in chloroplasts.

  

  Rice. 8. Variegation of night beauty Fig. 9. Variegation of snapdragons

  Spontaneous cytoplasmic mutations are detected less frequently than mutations of chromosomal genes. This can be explained by a number of reasons. Obviously, one of the reasons lies in the multiplicity of cytoplasmic structures and organelles. Any cytoplasmic mutation that arises in one of many identical organelles cannot manifest itself until it multiplies in the cytoplasm of the cell.

  A cytoplasmic mutation can manifest itself in two cases: if a given organelle in a cell is single or represented by a small and constant number, or if the mutagen has a specific effect on the cell organelles, causing a massive change in them.

  Chlamydomonas turned out to be a very convenient object for studying cytoplasmic mutations. Streptomycin causes a large number of mutations of non-chromosomal genes in her. When strains sensitive to this antibiotic were treated with streptomycin solution, mutants resistant to streptomycin were isolated.

Variability- the ability of organisms to acquire new characteristics. This leads to a variety of properties and characteristics in individuals of varying degrees of relatedness. Changes in phenotype can be associated either with environmental influences on gene expression or with changes in the genetic material itself. Depending on this, a distinction is made between non-hereditary (modification) variability and hereditary (genetic) variability.

Non-hereditary (modification) variability

Non-hereditary variability

• affects only the phenotype (the genotype does not change);
• not inherited;
• is adaptive in nature to environmental conditions.

The basis of modification variability is the fact that it is not the trait itself that is inherited, but only the ability to develop it. Depending on environmental conditions, the trait may manifest itself to varying degrees. The limits of variation (variability) of a characteristic are called reaction norm. The reaction norm depends on genes, and environmental conditions determine which option within this reaction norm is realized in a given case.

The reaction norms for various signs are not the same. As a rule, qualitative characteristics have a narrow reaction norm (for example, blood type), while quantitative characteristics have a wide reaction norm (for example, height and body weight).
It is possible to give an objective assessment of a variable trait only by analyzing a large number of individuals. To evaluate a characteristic, a variation curve is constructed and the average value of the characteristic is found. The values ​​of the attribute value form a continuous series around the average value. The most common are individuals with average development values ​​of the trait, and the more the trait deviates from the average value, the fewer individuals possess it.
As noted, a genotype is not a mechanical set of genes, that is, if there is a gene, then the trait must develop. The degree of expression and frequency of manifestation of individual genes in the phenotype depend on the interaction of genes in the genotype and the influence of the environment.

Expressiveness- degree of manifestation of a varying trait. Expressiveness characterizes the degree of deviation of a trait from its average value.

Penetrance- the degree of penetration of genes into a trait.

It is measured as a percentage of the number of individuals carrying a given trait to the number of individuals carrying a gene that can potentially be translated into a trait. The penetrance of a gene can be complete (100%) if this trait is observed in all individuals, and incomplete if it appears only in part of the population.

Hereditary (genotypic) variability

Hereditary variability

• affects the genotype;
• is inherited;
• is random.

Hereditary variability can be combinative and mutational.
Combinative variability arises as a result of the formation in descendants of new combinations of already existing genes during sexual reproduction.
The sources of combinative variability are

1. independent divergence of homologous chromosomes in the first-meiotic division and their random combination during fertilization;
2. recombination of genes as a result of crossing over.

Thus, in the process of combinative variability, the molecular structure of genes does not change, but new combinations of alleles in genotypes lead to the appearance of organisms with new phenotypes.
Mutational variability occurs as a result of mutations. Mutations - qualitative or quantitative changes in the DNA of organisms, leading to changes in their genotype.

Mutations are characterized by the following properties:

• these are sudden abrupt changes in heredity;
• these are persistent changes in hereditary material (passed on by inheritance);
• these are qualitative (discrete) changes (they do not form a continuous series around the average value);
• these are undirected changes (random in nature);
• can be beneficial (very rare), harmful (most mutations) and neutral (indifferent to the given conditions of existence of the organism);
• can be repeated (similar mutations can occur repeatedly).

There are several principles of classification mutations:

• by change in genotype: a) genetic; b) chromosomal; c) genomic;
• by changes in phenotype: a) morphological; b) biochemical; c) physiological; d) lethal, etc.;
• in relation to the generative path: a) somatic; b) generative;
• according to the manifestation of the mutation in a heterozygote: a) dominant; b) recessive;
• by localization in the cell: a) nuclear, b) cytoplasmic;
• by reasons of occurrence: a) spontaneous, b) induced.

Generative mutations - mutations of germ cells (transmitted during sexual reproduction). Somatic mutations - mutations of somatic cells (transmitted during vegetative propagation).
Gene (point) mutations associated with changes in the nucleotide sequence of the DNA of one gene. There are two mechanisms of gene mutations: the replacement of one nucleotide with another and the loss or insertion of one of them. As a result, a change occurs in RNA transcription and protein synthesis, which causes the appearance of new or changed characteristics. The insertion and deletion of nucleotides lead to more significant consequences than their replacement, since triplets are shifted and not one amino acid changes, but the entire further sequence of amino acids.

Chromosomal mutations are associated with the movement of chromosome sections. Changes in the structure of chromosomes may involve sections of one chromosome or different, non-homologous chromosomes. There are different types of chromosomal mutations:

The mechanism of chromosomal mutations is the formation of chromosome breaks under the influence of mutagens with the possible loss of some fragments and the reunification of parts of the chromosome in a different order compared to the original chromosome.
Genomic mutations associated with changes in the number of chromosomes. There are polyploidy and heteroploidy. Polyploidy- an increase in the number of chromosomes, a multiple of the haploid set (3n - triploidy, 4n - tetraploidy, etc.). The reasons for polyploidy can be different: the formation of gametes with an unreduced number of chromosomes during meiosis; fusion of somatic cells or their nuclei; duplication of chromosomes without subsequent cell division. Polyploidy is common in plants and rare in animals. Heteroploidy- a change in the number of chromosomes that is not a multiple of the haploid set (2n-1 - monosomy; 2n+1 - trisomy; polysomy, etc. on individual chromosomes). The cause of heteroploidy is the nondisjunction of individual homologous chromosomes during gametogenesis, resulting in the appearance of gametes in which some chromosomes are either absent or present in double numbers. Changes in the number of chromosomes often cause developmental disorders and even lethality. For example, Down's disease is caused by the presence of three chromosomes of 21 pairs.

Mutagenic factors

Mutagenic factors can be divided into two groups. On the one hand, mutations can occur spontaneously due to errors during DNA replication, repair and recombination. On the other hand, they can be caused by external causes - mutagens.
Mutagens - external (environmental) factors causing mutation. They are divided into physical (ultraviolet, x-rays and gamma rays, increased or decreased temperature), chemical (benzopyrene, nitrous acid), biological (some viruses).
Currently, as a result of human production activities, environmental pollution with mutagens is increasing. As a result, the number of mutations is growing both among people and among other living organisms. The vast majority of mutations are harmful, that is, they increase morbidity and mortality.
Often mutagens are both carcinogens - factors causing the development of malignant tumors.

A portion of the tobacco mosaic virus protein chain consists of the following amino acids: ser-gly-ser-ile-tre-pro-ser. As a result of the action of nitrous acid on mRNA, cytosine RNA is converted into guanine. Determine changes in the structure of the virus protein after exposure of mRNA to nitrous acid.

A fragment of a codogenic DNA chain normally has the following nucleotide order: AAAATCCAAATACTTATACAA. During replication, the fourth adenine and fifth cytosine on the left fell out of the chain. What is this type of mutation called? Determine the structure of the polypeptide chain encoded by this DNA region, normally and after the loss of nucleotides.

The DNA section encoding the polypeptide normally has the following nucleotide order: 5′AAAATCCAAATACTTATACAA 3′. During replication, the ACC triplet fell out of the chain. Determine how the structure of the polypeptide chain encoded by this DNA region will change. What is this type of mutation called?

What changes will occur in the structure of the protein if in the coding region of DNA: 5′ AAACAAGAACAAA 3′, between the 10th and 11th nucleotides include cytosine, between the 13th and 14th thymine, and at the end add another adenine ?

The fourth peptide in normal hemoglobin (hemoglobin A) consists of the following amino acids: val-gis-lei-tre-pro-glu-glu-lysine. In a patient with a symptom splenomegaly in moderate anemia, the following composition of the fourth peptide was found: val-gis-leu-tre-pro-lys-glu-lysine. What changes occurred in the structure of the DNA molecule encoding the fourth hemoglobin peptide after the mutation.

In a person who is sick cystinuria(the content in the urine of a greater than normal number of amino acids), amino acids are excreted in the urine, which correspond to the following triplets of mRNA: UCU, UGU, GCU, GGU, CAG, CGU, AAA. In a healthy person, alanine, serine, glutamic acid and glycine are found in the urine. Write the mRNA triplets corresponding to the amino acids found in the urine of a healthy person.

The gene region encoding the polypeptide normally has the following base order: 5′ AAGCAATCCATTAGTAATG 3′. What changes will occur in the protein if, during replication, a T insertion appears in the sixth codon between the second and third nucleotides?

In patients sickle cell anemia in 6th position  -chains of the hemoglobin molecule, glutamic acid is replaced by valine . How does the DNA of a person with sickle cell disease differ from that of a healthy person?

In the nucleotide sequence of the gene 5΄AAAGTTTAAACTGAAAAGGTS 3΄, the 5th and 9th nucleotides are lost. Determine the type of mutational damage and the structure of the protein normally and as a result of mutations.

1. Genomic mutations Samples of problem solving

When solving such problems, it is necessary to indicate which gametes merge to form a zygote with a given karyotype, then show the mechanism of the formation of these gametes in the process of meiosis.

Problem 1 : A karyotype has been established in human embryonic fibroblast cells

3A + XX. Explain the mechanism of occurrence of such a karyotype.

Solution:

The total number of chromosomes in karyotype 3A + XX is 22×3+2=68 chromosomes. A zygote with karyotype 3A + XX could arise from the fusion of: a normal egg (A + X) with an abnormal sperm (2A + X).

23 hrs. 23 hrs. 23 hrs. 23 hrs.

45 xp. 45 xp. 1 x 1 x

3A+XX = (A+X) + (2A+X)

Task 2: Explain the mechanism of occurrence of Down syndrome in a boy (47, XY, 21+)